this post was submitted on 23 Jul 2023
2 points (100.0% liked)

Memes

45666 readers
1606 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago
MODERATORS
 

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

no comments (yet)
sorted by: hot top controversial new old
there doesn't seem to be anything here